29 Previously, we observed that p38 MAPK is up-regulated in isolated microvessels from the brains of ALF mice.30 However, the role of p38 MAPK and MK-1775 supplier EGFR in BBB permeability in ALF has not been explored. In this study we investigated the role of p38MAPK/NFκB signaling after EGFR transactivation by MMP-9 in altering the TJ element occludin in brain ECs in vitro and in brains of mice with ALF. ALF, acute liver

failure; BBB, blood-brain barrier; EC, endothelial cell; EGFR, epidermal growth factor receptor; IκBα, I-kappa B alpha; MAPK, mitogen-activated protein kinase; MMP, matrix metalloproteinase; NFκB, nuclear factor-kappa B; RT-PCR, reverse transcription-polymerase chain reaction; SDS-PAGE, sodium dodecyl

sulfate-polyacrylamide gel electrophoresis; TJ, tight junction. The mouse brain endothelial cell line, bEnd3, was purchased from the American Type Culture Collection (CRL-2299, Manassas, VA). We purchased transfection-ready green fluorescent protein (GFP)-tagged human MMP-9 complementary DNA (cDNA) (RG202872) and p38 MAPK mouse cDNA (MC200120) from OriGene (Rockville, MD); anti-phospho p38 MAPK (sc9211), anti-p38 MAPK (sc9212), anti-MMP-9, anti-EGFR, and anti-phospho-Tyr EGFR antibodies (sc-13520) from Santa Cruz Biotechnology (Santa Cruz, CA); rabbit anti-claudin (Zy34-1600), anti-occludin (Zy71-1500), and anti-ZO-1 (Zy40-2300) from Invitrogen-Zymed Laboratories (Carlsbad, CA); and anti-ZO-2 buy Staurosporine from BD Transduction Laboratories (San Jose, CA). We obtained nontargeted SignalSilence control small interfering eltoprazine RNA (siRNA) (Cat. No. 6568), and p38 MAPK siRNA (Cat. No. 6564), EGFR siRNA (Cat. No. 6481) from Cell Signal Tech (Danvers, MA); anti-I-kappa B alpha (IκBα) (Cat. No. I0505) and p38 MAPK inhibitor SB203580 (Cat. No. S8307), MEK1/2 inhibitor PD 98059 (Cat. No. p215) from Sigma-Aldrich; NFκB inhibitor, MMP inhibitor GM6001, and EGFR inhibitor AG1478 from Calbiochem (San Diego, CA). Total RNA was extracted from bEnd3 cells using Purelink RNA Mini Kit (12183-018A, Invitrogen). RNA was transcribed into single-stranded DNA by

SuperScript III First Strand reverse transcriptase (18080-051, Invitrogen). The yielded cDNA was used as a template. PCRs for MMP-9, occludin, ZO-1, ZO-2, and claudin-5 were performed using Taq PCR Master Mix kit (201443 Qiagen). The primers were, for MMP-9, 5′-AGACGACATA GACGGCATCC-3′ (sense) and 5′-GCCCTGGATCT CAGCAATAG-3′ (antisense); for occludin (220 basepairs [bp]), 5′-CACACTTGCTTGGGACAGAGG-3′ (sense) and 5′-TGAGCCGTACATAGATCCAGGA GC-3′ 9 (antisense); for ZO-1 (290 bp), 5′-AGGCGC AGCTCCACGGGCTTCAGGAACTTG-3′ (sense) and 5′-CAGAAGCAGAAGTAGGGAGAGGTGCCG ATC-3′ (antisense); for claudin-5 (200 bp), 5′-GCT GGCGCTGGTGGCACTCTTTGT (sense) and 5′-G GCGAACCAGCAGAGCGGCAC-3′ (antisense); and for ZO-2 (240 bp), 5′-TCAAACCCCTCATCCG CTGCTGGTA-3′ (sense) and 5′-AGTGTTCCGTTT CAATGTCTCTTTTAC-3′ (antisense).