No. 88–7100-22; IL-12p70, Cat. No. 88–7121-22; TNF-α, Cat. No. 88–7324-22;

IL-6, Cat. No. 88–7064-22; IL-10, Cat. No. 88–7104-22) according to the manufacturer’s instruction. M-BMMs on day 5 from WT and Klf10-deficient mouse were stimulated with 1 μg/mL LPS for 12 and 24 h. Culture supernatants were analyzed for NO by the Griess reaction. Briefly, 50 μL supernatant was incubated with 50 μL Griess reagent for 5 min at room temperature, and NO2 level was determined by measuring the absorbance at 540 nm relative to the reference sample. Whole cell lysates were prepared by complete Lysis-M Protease Inhibitor Library solubility dmso kit (Roche; Cat. No. 04719956001) and the concentration was determined Selleck NVP-BGJ398 by the bicinchoninic acid protein assay (Thermo Scientific; Lot # MC 155209). The same amounts of protein were resolved on SDS-PAGE gels, transferred to polyvinylidene fluoride membrane. After blocking with 5% nonfat dry milk/PBS, the membranes were further incubated with the indicated primary antibodies overnight, reacted with a secondary antibody, and then protein bands were visualized by ECL. Cells were harvested and incubated with relative antibodies for 30 min on ice, washed, and analyzed in a FACS calibur flow cytometer (Becton Dickinson).

The promoter of IL-12p40 and its mutants were produced by PCR-based Vildagliptin amplification and subcloned into the pGL3-Enhancer Vector to forming luciferase report plasmid. Human embryonic kidney (HEK293) cells were cotransfected with 100 ng luciferase reporter plasmid, 10 ng thymidine kinase promoter-Renilla luciferase reporter plasmid, plus the pCDNA3-Klf10, or control vector. After 48 h, luciferase activities were determined by the Dual-Luciferase Reporter Assay System (Promega, Cat. No. E10910) according to the manufacturer’s instructions. The primers were as followed: P40-promoter-WT: CTCGAGTAGGCATGATGTAAACAGAAAT,   AAGCTTCTAGATGCAGGGAGTTAGC P40-promoter-Δ: CTCGAGTCATTTCCTCTTAACCTGGG,   AAGCTTCTAGATGCAGGGAGTTAGC P40-promoter-mut:

CTCGAGTAGGCATGATGTAAACAGAAATTA   GTATCTCTGCCTCCTTCCTTTTTCCAATCCCCGA,   AAGCTTCTAGATGCAGGGAGTTAGC Chromatin-immunoprecipitation assays were done essentially as the manufacturer’s protocol (Active motif, CHIP-ITTM Express). The immunoprecipitated DNA fragments were then analyzed by semi-qPCR and qPCR. The primers used were as followed: GAPDH: TTACTTTCGCGCCCTGAG, GCGGTTCATTCATTTCCTTC IL-12p40: TGCCGCCTCTATTCACCTTA, CTGACTAGTCTCAATTGCAACA Data are presented as the mean ± SD. Statistical significance was determined by Student’s t-test. A value of p < 0.05 was considered to be statistically significant. We thank L. Lu for discussions; F. Xing for assistance with manuscript editing.

In dams treated with CTB or CTB-PDI, IL-17A- and Foxp3-transcript levels were similar. Intranasal application of antigens represents an efficient and highly effective way of immunization. Following application upon the highly

resorbing mucosal surface, antigens are deposited directly to the appropriate immunocompetent lymphoid tissues, which then stimulate humoral and cellular immune responses, both locally and systemically in the mucosa [31-37]. In this study, CT adjuvant and the nontoxic B subunit CTB were employed for the intranasal vaccination of mice against challenge infection with N. caninum tachyzoites. We have reported earlier on the protection Doxorubicin ic50 against acute neosporosis in nonpregnant mice mediated by intranasally applied recNcPDI HCS assay emulsified in CT adjuvant [17, 18]. These findings were confirmed in this study. In contrast, application of CTB adjuvants alone or recNcPDI emulsified in CTB did not confer any protection against challenge infection with N. caninum tachyzoites but appeared to be exhibit detrimental effects, associated with a Th1-biased splenic cytokine transcript expression, but no changes in splenic IL-17A transcription (indicative for Inflammatory response) and Foxp3-transcript expression (indicative for Treg activation) when compared with an uninfected control. Conversely, the high-level protection observed

in the CT-PDI group was associated with an IgG1-biased humoral immune response Sclareol and significantly increased expression of Th2 cytokine and IL-17A transcripts in spleens compared with the CT control group, and Foxp3 transcript expression levels appeared diminished. However, when identically vaccinated mice underwent pregnancy and were challenged by N. caninum infection, the protective effect of CT-PDI vaccination was lost. The loss of protection was associated with a decreased expression of Th2 cytokine transcripts and increased expression of splenic Th1 cytokine and IL-17A transcripts. It is likely that this high expression of inflammatory cytokines, and associated increased cellular immunity, contributed to the

significantly increased number of stillborn mice in the CT-PDI group. In addition, the down-regulation of Foxp3 expression, indicating a decreased activity of Treg cells, could also have contributed to the lack of protection and/or could even have been detrimental to pregnancy. This suggested that vaccination with recNcPDI emulsified in CT clearly interfered in the balanced cytokine network, which is involved in ensuring a successful outcome of pregnancy. It was shown that the maintenance of the balance between Th1- and Th2-type immune responses during pregnancy is critical. Changes in hormone levels during pregnancy act on the innate and adaptive immunity and induce a Th2-type biased immune response by decreasing IFN-γ, TNF and IL-12 production and increasing IL-4 and IL-10 expressions or by affecting T-cell or APC functions directly [38].

It has been hypothesized that ITADT may be unable to induce efficient antitumour effects because injected DC residing Bafilomycin A1 mouse within the tumour cannot efficiently migrate to the lymph nodes [36]. However, in this study, we hypothesized that

this characteristic of the intratumourally delivered DC may enhance the antitumour effect of ITADT through the efficient mobilization of host-derived APC and the subsequently enhanced TAA-specific CD8+ T-cell responses. In our experiments, although small numbers of i.t.-injected DC were detected in the draining lymph nodes on day 1 of ITADT, the frequency of the injected DC in the draining lymph nodes was not correlated with the antitumour effects observed, but the survival

time of the injected DC within the tumour was correlated. These findings support our hypothesis regarding the antitumour effects of ITADT. We believe that skin-derived or blood-derived tumour-associated APC may be crucial for successful ITADT, and the longer the activated DC reside within the tumour, the more efficiently host-derived APC may mobilize to the tumour, engulf TAA, migrate into the lymph nodes and finally prime TAA-specific CD8+ T cells. This is not the case for SCDT, where endogenous DC in the lymph nodes participate in the amplification of the T-cell response [37], because the injected DC rapidly migrate into the draining lymph nodes [9]. However, it is likely that DC–tumour cell hybrids also Smoothened Agonist purchase may reside at the injected site. Such cells are large and cannot migrate

into lymph node, resulting in the efficient mobilization of host-derived APC [38, 39]. In DC-based immunotherapy, (-)-p-Bromotetramisole Oxalate allogeneic DC are considered an important source of DC for some patients, especially paediatric cancer patients. However, previously reported preclinical data have been negative about the efficacy of allogeneic DC in immunotherapy in which SCDT using peptide- or tumour lysate-pulsed fully allogeneic or semi-allogeneic DC were used [14, 22–24]. Alloreactive T-cell response to the alloantigens expressed by the injected DC themselves had been expected to provide the injected DC with additional danger signals via costimulatory-related molecules (such as CD40-CD40L signalling [40–42]) or bystander production of T-cell growth factors, resulting in enhanced priming of T-cell responses [21]. However, this positive effect of alloantigens in MHC-disparate donor–recipient combinations might only be obtainable in DC-based immunotherapy with DC–tumour hybrids, where fully allogeneic or semi-allogeneic DC–tumour cell fusions show enhanced antitumour effects compared with syngeneic DC–tumour cell hybrids [21, 38].

Because these intranuclear structures do not have a membrane, the components of nuclear bodies and nuclear structures can rapidly interact. Many components of nuclear bodies change quickly, and an increased retention time of each component at a place represents foci.[27, 51] Therefore, the interaction should be regulated temporally and rapid dissociation depends

on the circumstance. Finally, we examine the possibility that TDP-43 directly contributes to the formation of Gems. In TDP-43-depleted cells, selleck a substantial number of Gems were still observed, whereas TDP-43 was not detected in the nucleus or Gems.[34] In addition, not all Gems include TDP-43 in cultured cells and normal spinal motor neurons.[34] Moreover, the size of each Gem was similar between control and ALS cells.[34] These results clearly indicate that TDP-43 is not a necessary component for all types of Gems. Thus, we propose two possibilities regarding the contribution of TDP-43 in the formation of Gems: (i) TDP-43 contributes to the formation of Gems only at a specific stage during their maturation (Fig. 2a); or (ii)

TDP-43 is associated with only a subtype of Gems, but not all Gems (Fig. 2b). Interestingly, the overexpression of TDP-43 also decreased the number of Gems in the cultured cells,[34] indicating that the proper amount of each component is important for maintaining the number of Gems. One outcome of a decrease in the number of Gems can be speculated based on the molecular mechanism underlying spinal muscular buy Torin 1 atrophy. Gems are the sites of assembly and maturation of snRNP.[29, 31, 52] In the assembly of snRNP, SMN first forms a dimer and directly binds to Gemin 2, 3 and 8 and indirectly binds to Gemin 4, 5, 6 and 7 and unrip.[53] This SMN complex then binds to the Sm complex and U snRNA and transports them into the nucleus.[47] At the Gems, additional proteins are assembled to snRNPs and U snRNAs are modified, consequently forming a spliceosome, which functions for pre-mRNA splicing. In addition, Gems accumulate at most U snRNA genes.[30] These findings suggest that the Gems may regulate the quality

as well as the quantity of the U Reverse transcriptase snRNA. Therefore, researchers have speculated that the depletion of SMN or Gems may result in decreasing amounts of SMN complex, snRNPs and U snRNAs. Indeed, Gemin 2, 3 and 8 are decreased in SMN-depleted cells and tissues.[54, 55] In addition, the assembly of snRNP is also disrupted in these cells and tissues. Furthermore, a subset of U snRNA is decreased in the affected tissues in spinal muscular atrophy.[47, 54] The U snRNAs are involved in the splicing machinery, the spliceosome, and are categorized into major and minor classes depending on the consensus sequences of the donor and acceptor splice sites of the introns.[56] Most of the splicing is regulated by major spliceosomes, whereas less than 1% is regulated by minor spliceosomes.

Intravenous (i.v.) Ig (IVIG) also provides an important adjunctive treatment to control airway inflammation, reducing oral steroid requirements in severe bronchial asthma [4–7]. INK 128 purchase The efficacy of IVIG is due largely to IgG, which is a major portion of IVIG. Several roles of IgG in IVIG therapy in autoimmunity have been proposed [8–10], and the functions of IgG in IVIG therapy in allergic diseases are also envisaged to inhibit inflammatory reaction. Although these reports suggest that i.v.-administered

IgG have functions to protect against allergies and asthma, the precise target and mechanisms in allergic airway inflammation have not yet been revealed. In a murine experimental model, intranasal instillation of antigen-specific IgG reportedly learn more reduce eosinophilic inflammation and goblet cell hyperplasia induced by antigen challenge, suggesting that topical IgG reportedly counteracts allergic pulmonary inflammation that is dependent upon Fc and interferon (IFN)-γ[11]. However, clinical use of these therapies in bronchial asthma is currently limited because of the lack of evidence.

Clarifying the role of FcRs leads potentially to the development of a new strategy to manage asthmatic airway disorders. The role of antigen-presenting cells (APCs), including dendritic cells (DCs), in the pathogenesis of asthma has been clarified. When allergens are encountered in the airways, DCs in the airway epithelium capture allergens

and migrate to the draining lymph nodes, where they reside in a mature, antigen-priming mode [12]. There, antigen-specific T cells are induced to differentiate into Th effector cells or regulatory cells by these DCs. Thus, DCs are important in the initiation of T cell differentiation and activation and contribute indirectly to the development of ZD1839 in vitro airway inflammation. Targeting the inhibitory Fc receptor on DCs can potentially inhibit induction of the Th2 cytokine response. We hypothesized that i.v. IgG administration (IVIgG) inhibits allergic inflammation through inhibitory FcRs on immune cells to induce a Th2 response. Among several types of FcRs, FcγRIIb is a unique inhibitory FcR which regulates immune cell function [13]. To verify the inhibitory effects of IVIgG and FcγRIIb in bronchial asthma, we pursued the mechanisms of IVIgG using murine models of allergic airway inflammation induced by ovalbumin (OVA) sensitization and aerosol challenge. As IVIgG, we analyse the effects of both mouse IgG and xenogenic (rabbit) IgG to analyse the functions on FcRs.

, manuscript GDC 941 in preparation). We and Berlier et al.72 have demonstrated that SP also induces the expression of CCL20, a key chemotactic factor involved in recruitment and maturation of Langerhans cells and dendritic cells, which, together with intraepithelial T lymphocytes, are considered to be the first target cells for HIV genital mucosal infection.73–75 A common gene overexpressed in pathological conditions involving mucosal inflammation is cyclooxygenase (COX)-2. Semen exposure leads to overexpression of COX-2

in pig and mare endometrium.76,77 COX-2 catalyzes the rate-limiting step in the synthesis of prostaglandins from arachidonic acid.78 Prostaglandins are considered to be important biological modulators of inflammation. They attract immune cells to the area of inflammation. They also act in an autocrine/paracrine manner to elevate COX-2 expression.79,80 Seminal plasma contains 1000-fold higher concentration of prostaglandins, mainly PGE2, compared to normal endometrium.81 Seminal plasma PGE2 has been reported to induce

COX-2 in immortalized human endocervical cells.82 This induction is because Rapamycin mw of the intracellular activation of cAMP pathway via PGE2 receptor subtypes, EP2 and EP4. Our laboratory has demonstrated that SP also induces COX-2 in human vaginal cells (Joseph et al., manuscript in preparation). Furthermore, it potentiates COX-2 induction by microbial products such as bacterial lipopeptides (Fig. 1). This enhanced expression of COX-2 could be one of the main causes of inflammation associated with STIs and CV infections. In addition, SP has been shown

to activate multiple signal transduction pathways, which are involved in inflammatory responses. In cervical cells, SP induces the phosphorylation of extracellular signal-regulated kinase (ERK1/2) via EP4 receptor.83 In endometrial cells, SP induces the phosphorylation of c-Src, ERK, and activation of cAMP pathway via EP2 receptor.84 SP has also been shown to activate NF-kB signaling pathway in vaginal cells. This pathway is considered central to inflammation and is involved in the control of numerous proinflammatory genes including COX-2 and multiple chemokines and Docetaxel cytokines. NF-kB activation has also been linked to the enhancement of HIV replication.11 The role of semen in HIV-1 transmission is defined by a complex array of factors and processes involved in semen, virus, and female genital tract interactions. Semen carries CF and CA virus and is believed to be the main vector for HIV-1 in male-to-female sexual transmission. Seminal viral load varies with multiple factors such as stage of infection and disease in the male, presence of reproductive tract inflammation, and whether or not the man is on antiretroviral therapy. However, semen is more than a carrier for HIV.

[37] However, this

was demonstrated only in vitro in a non-physiological concentration of MnCl2 using SAHA HDAC isolated RSS substrates and not in the physiological 12RSS and 23RSS pair.[37] The in vivo scenario is still unclear though it is commonly thought that Mg2+ is the physiological divalent metal ion involved in RAG-mediated cleavage. RAG1 and RAG2 are assisted by high mobility group proteins of the HMG-box family (HMGB1 and HMGB2) for bringing two signal ends together. The HMG proteins interact with the nonamer binding domain of RAG1 in the absence of DNA and enhance its intrinsic DNA bending activity.[38] Following resolution of the hairpin structure, the coding ends are joined to create the exon, which forms the antigen-binding region of the antigen receptors (Fig. 2c). The signal ends remain bound to RAGs, which in turn protect the Omipalisib solubility dmso ends from further nuclease digestion [36, 39] (Fig. 2c). The blunt-ended signal ends can be directly ligated without any modification, while the coding ends undergo further processing (Fig. 2c).[34,

35] The hairpin at the coding end is opened and joined together by non-homologous end joining (NHEJ), the DNA double-strand break repair pathway.[40, 41] Artemis, in conjunction with DNA-PKcs, acts as an endonuclease and resolves the hairpins formed during V(D)J recombination.[42] Ku heterodimer, consisting of Ku70 and Ku80, binds to the broken DNA ends and forms a complex with DNA-PKcs.[43] Artemis has an inherent 5′-3′ exonuclease activity, whereas in association with DNA-PKcs it acts as a 5′-3′ endonuclease.[42] The ends are filled in by the Pol X family of polymerases namely Pol μ and

Bumetanide Pol λ. Mice deficient in Pol μ are shown to have shorter immunoglobulin light chain V to J junctions,[44] while those lacking Pol λ have shorter immunoglobulin heavy-chain D to J and V to DJ junctions.[45] In addition, Pol μ plays a role in the processing of 3′ ends while Pol λ processes the 5′ ends.[45] This would suggest that Pol μ is involved in V(D)J recombination, but not Pol λ.[46] The ligase IV/XRCC4 complex ligates the processed ends[47, 48] with the help of XLF.[49, 50] Ku70, Ku80, XRCC4 and Ligase IV are considered to be the ‘core’ NHEJ factors as these proteins were conserved during evolution and are required for all known NHEJ reactions.[51, 52] These are also inevitable for the joining of both coding and signal ends. On the other hand, DNA-PKcs and Artemis are believed to have evolved more recently and are needed only for the joining of coding ends.[52] At the time of joining of V, D and J subexons, several modifications like insertions and deletions can occur at the junctions resulting in further increase in the antigen receptor diversity. Asymmetric hairpin opening at the coding ends due to nicking a few bases away from the terminus results in one DNA strand longer than the other.

For the treatment of Class III or Class IV LN, alone or in combination with Class V features, members of the ALNN agreed on the following: It is important to expedite the investigative and diagnostic process to aim for starting treatment early, since delay of effective LBH589 in vivo treatment implies continuous attrition of nephron mass, renal reserve, and a negative impact on renal survival. Initial (induction) treatment should be combination immunosuppression comprising high-dose corticosteroids

and an immunosuppressive agent. The latter can be intravenous pulse CYC, MMF, or oral CYC for a limited duration, and the choice INCB024360 cost takes into consideration cost, compliance, geographical access, and reimbursement policy. The duration of this ‘induction’ phase lasts four to six months. There was consensus that intravenous pulse corticosteroid treatment, at a dose of 250–1000 mg methylprednisolone daily for three days, should be administered to patients with crescentic involvement of 10% or more of the glomeruli

on renal biopsy, or those with deteriorating renal function attributed to the nephritic process. There were diverse opinions on the use of pulse corticosteroid in patients with lesser degrees of disease severity. Following

pulse corticosteroid therapy, oral prednisolone is commenced at a dose of 0.5–0.6 mg/kg daily, while the starting dose is 0.8–1.0 mg/kg daily when not preceded by intravenous pulses. The dose of oral corticosteroids next is thereafter tapered to target a dose of prednisolone below 20 mg daily after 3 months, and below 10 mg daily at 6 months from baseline. Combination immunosuppression with corticosteroids and MMF is considered a standard-of-care treatment option, in view of the published data demonstrating its efficacy and tolerability in the majority of Asian patients treated with this regimen.[31-33, 35] However, it should be noted that patients with crescentic LN and rapidly deteriorating renal function were often excluded from prior clinical trials. Also, the results of a post-hoc analysis of pooled data suggest that while the short-term efficacy was similar between MMF or CYC based induction treatment in patients with Class III/IV LN and renal impairment, CYC induction may be associated with more sustained remission and more favorable long-term renal outcome.[72] It is therefore important to monitor the responsiveness when MMF is used to treat patients with very severe disease.

8%), breast cancer (105/639; 16.4%), melanoma (67/639; 10.5%), Selleck Opaganib renal cell carcinoma (RCC; 52/639; 8.1%) or colorectal cancer (CRC; 71/639; 11.1%) were available. Specimens of the corresponding primary tumor were available in 113/639 (17.7%) cases. Median Ki67 index was highest in CRC BM and lowest in RCC BM (p<0.001).

MVD and HIF-1 alpha index were both highest in RCC BM and lowest in melanoma BM (p<0.001). Significantly higher Ki67 indices, MVD and HIF-1 alpha indices in the BM than in matched primary tumors were observed for breast cancer, non-small cell lung cancer (NSCLC), and CRC. Correlation of tissue-based parameters with overall survival (OS) in individual tumor types showed a favorable and independent prognostic impact of low Ki67 index (HR 1.015; p<0.001) in NSCLC BM and of low Ki67 index (HR 1.027; p=0.008) and high angiogenic activity (HR 1.877; p=0.24)

in RCC. Our data argue for differential pathobiological and clinical relevance of Ki67 index, HIF1-alpha index and MVD between primary tumor types in BM patients. An independent prognostic impact of tissue based characteristics was observed in patients with BM from NSCLC and RCC, supporting the incorporation of these tissue-based parameters into diagnosis-specific prognostic scores. “
“M. Kuronen, M. Hermansson, O. Manninen, I. Zech, M. Talvitie, T. Laitinen, O. Gröhn, P. Somerharju, M. Eckhardt, J. D. Cooper, A.-E. Lehesjoki, U. Lahtinen and O. Kopra (2012) Neuropathology and Applied Neurobiology38, 471–486 Galactolipid deficiency in the

early pathogenesis STK38 of neuronal ceroid lipofuscinosis model Cln8mnd: implications CP-868596 nmr to delayed myelination and oligodendrocyte maturation Aims: CLN8 deficiency underlies one of a group of devastating childhood neurodegenerative disorders, the neuronal ceroid lipofuscinoses. The function of the CLN8 protein is currently unknown, but a role in lipid metabolism has been proposed. In human CLN8 diseased brains, alterations in lipid composition have been detected. To further investigate the connection of CLN8 to lipid metabolism, we characterized the lipid composition of early symptomatic Cln8-deficient mouse (Cln8mnd) brains. Methods: For lipid profiling, Cln8mnd cerebral cortical tissue was analysed by liquid chromatography/mass spectrometry. Galactolipid synthesis was measured through enzyme activity and real-time mRNA expression analyses. Based on the findings, myelination and white matter integrity were studied by immunohistochemistry, stereological methods, electron microscopy and magnetic resonance imaging. The development of myelin-forming oligodendrocytes was also studied in vitro. Results: Sphingolipid profiling showed a selective reduction in myelin-enriched galactolipids. The mRNA expression and activity of UDP-galactose:ceramide galactosyltransferase (CGT), the key enzyme in the galactolipid synthesis, was reduced in the Cln8mnd brain. Expression of oligodendrocyte markers suggests a maturation defect.

Additionally, in the primate complexes, sequences highly homologous to five exons of CLEC-2 were found in the genomic region directly upstream of the CLEC9A gene (CLEC-2 exon 2: 96%, CLEC-2 exon 3: 91%, CLEC-2 exon 4: 90%, CLEC-2 exon 5: 87% and CLEC-2 exon 6: 88%). This suggests that a duplication of exons 2–6 of the CLEC-2 gene followed by an inversion of the region containing the complete CLEC-2 and CLEC12B genes has taken place in a common primate ancestor (Fig. 1B). Interestingly, sequences highly homologous to parts of the CLEC2 gene were also found in the 5′-UTR of CLEC9A mRNA, indicating that selleckchem upstream untranslated exons 1 and 3 of CLEC9A are derived from intronic

regions, while exon 2 is derived from the second CTLD exon of an ancestral CLEC2 gene. These three exons upstream of the coding region of CLEC9A form a 5′-UTR of about 640 bp which contains an open reading frame (ORF) selleck compound library of 273bp starting at position −362 and ending at position −87 relative to the CLEC9A translation initiation

site. Because mini ORF in the untranslated region of several genes have been shown to interfere with the translation of the corresponding proteins [34–36], it is of interest to note that the existence of an internal ribosomal entry site (IRES) is predicted directly 5′ of the start codon (position −93 to −1), which could mediate 5`-end-independent ribosomal attachment to an internal position in the mRNA and could thereby facilitate CLEC9A translation. Based on the analysis of their protein sequences, the genes of the NK gene complex can be classified into two distinct subgroups. The first group of genes indeed encodes lectin-like receptors that show the typical lectin structure consisting of six exons coding for a N-terminal cytoplasmic region, a transmembrane

region, a neck region and three C-type lectin-like domains [37]. The second group consists only of the two proteins, FLJ31166 and GABARAPL1, and both do not code for lectin-like receptor proteins. Homologies were detected only for transmembrane regions of human and murine FLJ31166, but not for other protein domains, nor was it possible to find homologies to other known through proteins. The exon–intron structure of human und murine GABARAPL1 is made up of four coding exons, and the protein does not contain a transmembrane region. The first exon has been reported to encode a tubulin-binding site, whereas the sequences of exons three and four code for a GABA receptor-binding site [26]. Regarding their amino acid sequences, lectin-like receptors share common characteristics, such as six highly conserved cysteine residues in the extracellular part of the protein, and some also contain motifs involved in Ca2+- and ligand binding, namely EPN (mannose binding)/QPD (galactose binding) and WND [3, 37]. As shown in Fig. 2A, the human and murine homologues of the novel lectin-like proteins CLEC12B and CLEC9A show most of the typical features of lectin-like receptors.