These tumors are typically slow growing, with an indolent but progressive clinical course. We present a case of a highly proliferative chordoma arising in a 73-year-old woman with unusually rapid clinical growth and aggressive histologic and immunohistochemical features. This patient had an unusually brief preclinical course and within 1 month of developing headaches presented to medical attention with diplopia.

The resected chordoma showed uncommonly elevated mitotic activity, without the histologic hallmarks of de-differentiation. This proliferative activity correlated with elevated Ki67 staining (60%), B-cell leukemia/lymphoma1 (BCL1) expression Dorsomorphin purchase (100%), and topoisomerase

IIα staining (>95%). E-cadherin expression was also lost throughout the majority of the tumor. Other markers of epithelial mesenchymal transition (EMT) including vimentin, N-cadherin, Slug and Twist, were also strongly expressed in this aggressive tumor. The sellar component of the tumor recurred within a 2-month interval. The evaluation of the additional biomarkers, including makers of EMT studied in this, case may allow for identification of aggressive chordomas in which the tempo of disease is significantly more rapid than in typical cases of chordoma. “
“Balamuthia mandrillaris is an amoeba found in fresh water and soil that causes granulomatous Resveratrol amoebic encephalitis. We report herein an autopsy case of B. mandrillaris BTK signaling inhibitors amoebic encephalitis, which was definitely diagnosed by PCR. An 81-year-old man, who had Sjögren’s syndrome, manifested drowsiness 2 months before his death with progressive deterioration.

Neuroimaging demonstrated foci of T2- and fluid-attenuated inversion recovery high and T1 low-intensity with irregular post-contrast ring enhancement in the cerebral hemisphere, thalamus and midbrain. Pathologically, multiple hemorrhagic and necrotic lesions were found in the cerebrum, thalamus, midbrain, pons, medulla and cerebellum, which were characterized by liquefactive necrosis, marked edema, hemorrhage and necrotizing vasculitis associated with the perivascular accumulation of amoebic trophozoites, a few cysts, and the infiltration of numerous neutrophils and microglia/macrophages. The trophozoites were ovoid or round, 10–60 μm in diameter, and they showed foamy cytoplasm and a round nucleus with small karyosome in the center. The PCR and immunohistochemistry from paraffin-embedded brain specimens revealed angioinvasive encephalitis due to B. mandrillaris. Human cases of B. mandrillaris brain infection are rare in Japan, with only a few brief reports in the literature. “
“C. Troakes, T. Hortobágyi, C. Vance, S. Al-Sarraj, B. Rogelj and C. E.

Here, we select a few recent discoveries in cancer and cardiovascular disease that implicate a role for monocytes and discuss how studies in cardiovascular disease can provide insights into cancer and, vice versa, how studies in cancer can influence research on cardiovascular disease (Fig. 1). Atherosclerosis is an inflammatory chronic disease that leads to myocardial infarction and stroke 6–8. Advances in basic science over the past 20 years have uncovered a pivotal role for the immune system in mediating all disease stages, from onset to progression and complication. Various leukocytes have been find more shown to influence atherogenesis. Among these, monocytes and their descendant macrophages

are GDC-0068 in vivo central protagonists. As disease worsens, circulating monocyte numbers rise whereas in models where monocytes are depleted atherosclerosis does not develop. Monocyte migration to the vessel wall is a key event in the growth of atherosclerotic lesions. Upon accumulation, monocytes differentiate into macrophages and lipid-rich

foam cells, which are the key culprits associated with clinical complications 9, 10. The capacity of macrophages to reduce overall plaque stability and to promote thrombosis is discussed in the article by Thorp et al. in this issue 11. Compelling evidence suggests that cell-extrinsic mechanisms mediated by seemingly normal host cells regulate tumorigenesis, growth and metastasis. Monocytes and their lineage-descendant macrophages are often the most abundant host cells in the tumor bulk. These cells can be co-opted by carcinoma cells and operate as components of an inflammatory response that

construct a supportive stroma 12–14. Breast cancer grows at a slower pace in mice that lack M-CSF and, conversely, at a faster pace when M-CSF concentrations are artificially increased 15. Additionally, most – although not all – clinical studies have reported that the density of tumor-associated macrophages (TAMs) correlates with adverse outcomes and shorter survival times 15–17. Although TAMs are “plastic” cells and therefore can express distinct phenotypes in different tumor microenvironments and/or at different times during tumor development 15, it is commonly accepted Abiraterone in vivo that they critically participate in tumor growth. The article by Mantovani et al. in this issue discusses the diversity of TAM and the capacity of these cells to be re-educated to exert anti-tumor functions 18. During murine atherosclerosis, Ly6Chigh CCR2high monocytes expand and accumulate in lesions via the additive expression of CCR2, CCR5 and CX3CR1, whereas Ly6Clow CCR2− cells accumulate to a lower extent and do so only via CCR5 19–22. The proliferation of the Ly6Chigh CCR2high subset is associated with hypercholesterolemia, suggesting that lipids influence monocytopoiesis.

The interface was collected and stained with fluorophore-conjugated anti-CD4, anti-CD8, anti-F4/80, anti-CD11b, and anti-B220. Flow cytometry analysis was conducted using a FACSCalibur and analyzed using Flowjo software (Treestar). Statistical analysis of the uveitis scores was performed using the Mann–Whitney U-test. Cytokine-producing cell numbers were analyzed using Student’s t-test. The authors are grateful to Dr. Masaru Taniguchi

at the RIKEN Research www.selleckchem.com/screening/tyrosine-kinase-inhibitor-library.html Center for Allergy and Immunology for kindly providing Jα18-deficient mice. This research was supported by grants from MarineBio Technology Project funded by Ministry of Land, Transport and Maritime Affairs (D. S. L.) and from Korea Healthcare technology R&D Project funded by Ministry for Health, Welfare & Family Affairs (No. A084022) (D. S. L.). Conflict of interest: The authors declare no financial or commercial conflict of interest. Detailed facts of importance to specialist readers are Dinaciclib purchase published as ”Supporting Information”. Such documents are peer-reviewed, but not copy-edited or typeset. They are made available as submitted by the authors. “
“To investigate ageing-associated changes in cellular immunity, we recruited three groups of healthy subjects based on SENIEUR protocol criteria. In addition, 10 subjects were randomly selected

from each group to isolate their T cells from peripheral blood mononuclear cells; T cell proliferation after phytohemagglutinin (PHA) stimulation was determined by methyl thiazolyl tetrazolium assays. There were no marked differences in the absolute numbers of peripheral blood T cells, NK cells or B cells among the three groups (P > 0.05). Also, no significant differences were noted in the

numbers of CD4+ cells, CD8+ cells, or the CD4+/CD8+ ratios (P > 0.05). After PHA stimulation, T cell proliferation was markedly increased, with the highest 4-Aminobutyrate aminotransferase level in group C and the lowest level in group A (P < 0.05). Cytokine-induced killer tumouricidal activities were also dramatically increased, with the highest activity in group C and the lowest activity in group A (P < 0.05). Our findings suggest that the number of immune cells remains unchanged with advanced age. However, there is a trend for decreased cellular immunity with an increase in age. The current increase in ageing populations worldwide has promoted the study of gerontology-related issues. Elderly populations are more susceptible to bacterial and viral infections, malignancies and autoimmune diseases, which may be attributed to compromised or dysfunctional immune system functions. Thus, investigating the nature of immunological changes with respect to ageing has been the focus of numerous studies in gerontology.

ucsc.edu/cgi-bin/hgGateway) with selected tracks from ENCODE [20] and GEO databases (naïve CD4+ and Th1 cells: GSE26550, [21]; BMDM: GSE33802 [22]. (B) Analysis of relative resistance to MNase. Data normalized to control MNase-digested genomic DNA and b-actin are shown as mean ± SD of two experiments. Figure S8. Methylation status of TNF promoter in mouse T cells and bone marrow-derived macrophages DNA was isolated from mouse ES cells, embryonic fibroblasts (MEF),

BMDM and various T cells, demethylated by Imprint DNA Modification Kit (Sigma-Aldrich) according to the manufacturer’s instructions and used as template for PCR with primers for amplification of the proximal (forward TGGGTTAGTGAGTGAAAGGGATA, reverse AAATTTCAATTCTCAAAATCCTATACA) and distal (forward GGAATGAATTTAGTTTTGGGAATT, reverse AAATAAACTAAAAAAATCCATCCAAA) parts of mouse TNF promoter. Amplified DNA fragments, Volasertib corresponding to proximal (CpG sites from -255 to +7) and distal (CpG sites from -849 to -670) TNF promoter regions were cloned to TOPO TA Cloning® Kit for Sequencing

(Invitrogen, Carlsbad, CA, USA) and sequenced with BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Austin, TX, USA). From two to nine individual clones were analyzed. Stimulated cells were treated 3 hours with 4 μg/ml of anti-CD3 and 1 μg/ml of anti-CD28 antibodies (αCD3/αCD28) or 10 ng/ml of PMA and 1 μg/ml of Ionomycin (P/I). Figure S9. Binding of NFkB family members to the regulatory elements of the TNF/LT

AP24534 nmr locus in bone marrow derived macrophages (BMDM) and dendritic Thymidine kinase cells (BMDC) ChIP-Seq analysis of mouse bone-marrow derived macrophages (GSE16723 [23]) (A) and dendritic cells (GSE36099 [24]) (B) Figure S10. Control of efficiency of T cell polarization T cells were isolated and polarized as described in Materials and Methods and Supporting Information Table 4. Th0s, Th2s and Th17s cells were polarized in the presence of soluble anti-CD3 antibodies; Th0i, Th1i and Th2i cells were polarized in the presence of immobilized anti-CD3 antibodies. Cells were stimulated by 10 ng/ml PMA and 1 μg/ml Ionomycin for 4 hours in the presence of 5 μg/ml of Brefeldin A and fixed for at least 30 min with 2% paraformaldehyde in PBS. Further washing and staining steps were performed in PBS/BSA/EDTA buffer supplemented with 0.5% Saponin. Cells were analyzed on a FACSCalibur, FACS-Canto or Fortessa (BD Biosciences, Franklin Lakes, NJ, USA) flow cytometers using CellQuest (BD Biosciences) and FlowJo 7.6 (Tree Star, Inc., Ashland, OR, USA) software. Data shown are representative of five experiments. “
“The type III secretion system (T3SS) plays a key role in the exertion of full virulence by Bordetella bronchiseptica. However, little is known about the environmental stimuli that induce expression of T3SS genes.

Either the volunteer or a relative gave their written informed consent, and the study was approved by the ethical committee of Hospital District of Southwest Finland. Exclusion criteria were the consumption of antibiotics in the last selleck month and use of medication expected to either affect the immune function and/or the intestinal microbiota of the subject. Another exclusion criterion was the habitual use of pro- and/or prebiotic-containing products. The study protocol consisted of three consecutive phases. In phase 1, the subjects

consumed a control cheese during breakfast for 2 weeks (run-in). In phase 2, the subjects consumed a probiotic cheese for 4 weeks (intervention). In phase 3, the subjects consumed the same control cheese Selumetinib manufacturer again for 4 weeks (wash-out). The products were blinded to the volunteers and were identical in taste and appearance. The total duration of the study was 10 weeks, and during the time, the food at the elderly home remained stable. Heparinized peripheral blood (9 mL) was drawn by a venipuncture from each subject at baseline (T0), after run-in (T1), after intervention (T2), and after wash-out (T3) for immunological analysis. On the same occasion, a blood sample was collected for general health monitoring tests carried out at the University of Turku Hospital. The probiotic and the control Gouda cheese were commercial products (Mills DA, Oslo, Norway). Identical slices

of both types of cheese (15 g) were prepared and packed before the commencement of the study. The probiotic cheese slice contained approximately 109 CFU of L. rhamnosus HN001 (AGAL NM97/09514) and L. acidophilus NCFM (ATCC 700396). The viability of the strains was assessed throughout the study and was observed to remain stable. Both probiotic and control cheese contained proprietary starter strains (Choozit 712™, Danisco, Paris). The volunteers consumed one slice of cheese per day during breakfast. The probiotic cheese had been on the Norwegian

market for approximately 1 year. The probiotic strains Enzalutamide cost have been in commercial use for approximately 7 years (L. rhamnosus HN001) and 30 years (L. acidophilus NCFM) and have substantial safety and efficacy data (Shu et al., 1999; Zhou et al., 2000; Gill & Rutherfurd, 2001; Sanders & Klaenhammer, 2001; Sheih et al., 2001). The same probiotic cheese was tested for bacterial survival using a human gastrointestinal tract-simulating model, and it was shown that the strains (L. acidophilus NCFM and L. rhamnosus HN001) survived the simulated upper gastrointestinal tract (Makelainen et al., 2009). The cytotoxicity of the peripheral blood mononuclear cells (PBMCs), proportions of CD3−CD56+ cells (NK cells), CD3+CD56+ cells (NKT cells), CD3+CD56− cells, and CD3−CD56− cells in the total PBMCs, and phagocytic activity were assessed using flow cytometry (FACScan flow cytometer, BD biosciences). The data were analyzed using cellquest pro software.

brasiliensis can induce an asthma-like pathology when delivered intranasally to sensitized mice, including eosinophilia and production of IgE and Type 2 cytokines (38). Cross-regulation of Type 1 and Type 2 cytokines has been

an area of profound interest in immunology for the last 25 years and studies Selleckchem Fulvestrant with N. brasiliensis have contributed to the in vivo confirmation, or in some cases, a “reality check”, on the myriad of in vitro studies. Intranasal delivery of Mycobacterium bovis-Bacillus Calmette Guerin (BCG), a strong inducer of Type 1 cytokines, can inhibit local and regional production of Type 2 cytokines and airway eosinophilia induced by N. brasiliensis and this is dependent on IFN-γ (39). Conversely, IL-4 can inhibit generation of IL-2 in a Blimp-1-dependent manner (40). Le Gros’ former postgraduate students Ben Marsland and Nicola Harris (now at the Swiss Federal Institute of Technology, Zurich, Switzerland) continue to use N. brasiliensis to develop our understanding of helper T cell differentiation

and function. Their recent publications develop on Selleckchem DMXAA interests from the Le Gros laboratory, including the roles of protein kinase C theta (41), IL-21 (42) and parasite products (43) in the differentiation of Type 2 cytokine-secreting CD4+ T cells and in the immunopathology of inflammatory lung disease (44). Although blood and tissue eosinophilia are often seen in humans with tissue-invasive helminth infections, it is not easy to determine whether these leucocytes can protect against parasites (45). Studies of N. brasiliensis infections conducted in Lindsay Dent’s laboratory (University of Adelaide, South Australia) began in 1993, aided by the earlier experiences of his colleague Graham Mayrhofer, who had explored IgE and mast cell responses in infected rats (46–49). Dent, Mayrhofer and colleagues set out

to explore the role of eosinophils in resistance to N. brasiliensis and other nematodes using CD2/IL-5 Resminostat transgenic (Tg) mice generated in Colin Sanderson’s laboratory at the National Institute for Medical Research (NIMR, Mill Hill, UK) (50). These animals, originally produced on a CBA/Ca background and later also backcrossed into the BALB/c and C57BL/6 backgrounds (51), have constitutive eosinophilia in the peripheral blood, spleen and bone marrow. Early experiments initiated at NIMR suggested that IL-5 Tg mice do not have enhanced resistance to primary peritoneal infection with the cestode Mesocestoides corti (52), or primary or vaccine-induced resistance to the trematode Schistosoma mansoni (53) and also develop only modest lung inflammation and pathology in response to the aeroallergen chicken ovalbumin (OVA) (54). As with infections with S. mansoni (53), IL-5 Tg mice are also actually more susceptible than wild-type (WT) littermates to T. spiralis (54) and Plasmodium chabaudi (Dent and Brown, unpublished). Our findings with primary T.

Moreover, emerging evidence supports a direct correlation between DC numbers and the proliferation rate of peripheral Treg. Thus, Fms-like tyrosine kinase 3 ligand (Flt3L) treatment, which results in the in vivo expansion of classical DC (cDC) 11 leads to a concomitant increase in peripheral Treg 12, 13. Furthermore, it was recently demonstrated that the conditional ablation of cDC from otherwise intact animals results in reduced numbers and impaired homeostatic proliferation of peripheral Treg 13. Here, we readdressed the

role of cDC in the maintenance of peripheral Treg focusing on the role of CD80/86 costimulation. Using constitutive and conditional cDC ablation strategies, we established that peripheral Treg maintenance critically

depends on the presence of cDC expressing CD80/86. Surprisingly however and defying earlier notions 13, 14, the reduction of Treg in animals BMS-907351 clinical trial lacking cDC as such was not inherently associated with lymphocyte activation. Rather than resulting from a tolerance Afatinib concentration failure, the autoinflammatory signatures reported for cDC-deficient mice are thus a consequence of the nonmalignant myeloproliferative disorder these animals develop. We and others recently reported that animals that constitutively lack cDC (CD11c-DTA mice) display normal percentages and numbers of thymic Foxp3+ Treg 14, 15, thereby establishing that DC are dispensable for the generation of nTreg. Moreover, CD11c-DTA mice retained functional peripheral Treg 15. However, closer examination of the blood circulation and LN of cDC-deficient animals and comparison to their littermate controls revealed

a twofold reduction in the frequencies of Treg out of total CD4+ T cells, whose numbers are unaltered 15 (Fig. 1A). This reduction of peripheral Foxp3+ Treg was also observed upon conditional cDC ablation, as achieved through repetitive diphtheria toxin (DTx) treatment of [CD11c-DTR>WT] BM chimeras (Fig. 1B) 16, thereby confirming recent reports that established the critical role of cDC Adenosine in promoting the homeostatic Treg proliferation 13, 17. Re-examination of Treg frequencies in cDC-deficient animals by staining for both Foxp3 and CD25 revealed a twofold reduction of Foxp3+CD25+ (double positive) Treg in all organs tested, including the spleen (Fig. 1C–E). Interestingly though, the decrease of splenic Foxp3+CD25+ Treg was uniquely associated with a concomitant elevation in the frequencies of Foxp3+CD25− (single positive) cells out of CD4+ T cells (Fig. 1E). This finding explains the reason why the splenic Foxp3+ T-cell compartment of cDC-deficient CD11c:DTA mice had, in the previous studies, appeared unaffected 14, 15. Collectively, these data establish that although cDC are not required for the generation of nTreg in the thymus, they are – in agreement with recent reports 13, 17 – critically involved in the maintenance of peripheral Foxp3+CD25+ Treg.

H-gal-GP is a complex; the component proteins of which have not been separated without the aid of denaturing conditions. Under native polyacrylamide gel electrophoresis (PAGE), the complex runs as one large band of about 1 mDa and different batches show consistent band patterns on SDS PAGE (7). Visual confirmation of the complex has been provided by electron

microscopy (8). The predominant components of H-gal-GP have been identified as proteases including two pepsin-like aspartyl proteases, four metalloendopeptidases and a family of cysteine proteases (7). These proteases have been separated from the denatured complex, but when these or recombinant versions of them were evaluated in vaccine trials the degree of protection afforded was much lower than that obtained with the intact complex (9,10). Enzymatic

assays have been carried out to ascertain the function learn more of H-gal-GP and its component parts (7,11,12). The complex digests Wnt inhibitor haemoglobin with the maximum overnight turnover observed at pH 4·0; an activity which is reduced by 91% in the presence of pepstatin A. It also cleaves the aspartyl protease peptide substrate PTEFF(NO2)RL with a maximum hydrolysis rate observed at pH 5·0 (7,11). The identification of the major H-gal-GP component proteins as proteases, together with its location on the luminal surface of the parasite intestinal cells, supports the hypothesis that it is involved in the digestion of the blood meal. When sheep are immunized with H-gal-GP, they respond with high titres of antibody and it is hypothesized that such antibodies might inhibit digestion of the blood meal, leading to starvation of the parasite. The main aim of this study was to investigate these hypotheses by quantitatively monitoring the digestion of

ovine haemoglobin by H-gal-GP and to determine whether this process could be inhibited by specific antibodies. H-gal-GP was prepared from 21-day adult H.  contortus as described previously with the addition of 0·25% CHAPS to the peanut elution Rebamipide buffer containing 0·5 m galactose in 10 mm Tris–HCl, 0·5 m NaCl, 0·02% NaN3 with 100 μm Ca2+ 10 μm Mg2+ at pH 7·4 and replacing Triton X-100 with CHAPS in the desalt buffer (used with the Sephadex G-25 column) (13). The resulting desalted H-gal-GP was concentrated using an Amicon Ultra-15 centrifugal device, passed through a 0·22-μm syringe filter and stored at −20°C in 100-μL aliquots. Seventeen millilitre of blood from worm-free sheep at the Moredun Research Institute, collected in sodium heparin tubes, was mixed gently with cold PBS, added to a total volume of 100 mL and centrifuged at 600 × g, 4°C for 10 min. The solution separated during centrifugation and the red blood cell pellet was retained. This step was repeated five times.

Secondly, 8–9-week-old euglycaemic female NOD mice were divided into four 16-mice experimental groups treated with human apoTf at doses of 0·1, 1 and 2·5 mg/kg or PBS six times a week for

12 consecutive weeks [13]. These treatment regimens were chosen on the basis of selleck chemicals llc the different natural course of disease development in the DP-BB rats and the NOD mouse. Most female NOD mice, which exhibit a higher incidence of the disease than males, develop hyperglycaemia by the age of 35 weeks after a prolonged prediabetic period characterized from progressive insulitis that initiates from the age of 4–5 weeks [14]. In contrast, T1DM, that has a similar incidence in male and female DP-BB rats, is characterized from a more rapid course than that observed in the NOD mouse, with most of the animals developing diabetes by the age of 120 days after a short period of insulitis that develops in a non-synchronous manner between the ages of

30 and 60 days [15]. Accordingly, both in the NOD mice and the DP-BB rats, we initiate treatment under a ‘late prophylactic’ at a time when most of the animals have developed signs of insulitis. As established previously, type 1 diabetes was diagnosed in the presence of 2 consecutive days of detectable glycosuria and plasma glucose levels ≥200 mg/dl [12] using a FreeStyle Glucometer (Abbot, Abbot Park, IL, USA) and all experiments were performed in duplicate. Animals were killed when the diagnosis check details was made. To evaluate the impact of apoTf on the development of insulitis and the production of cytokines, euglycaemic 5-week-old female NOD mice were treated for 12 consecutive weeks with either apoTf (2·5 mg/kg, n = 24) or its vehicle (n = 20) and then killed to collect pancreas, blood samples, spleens and pancreatic lymph nodes for histological and immunological analyses [16]. For the histological examination of pancreatic islets, samples were fixed in Bouin’s solution embedded in paraffin for light microscopy [17]. Serial sections (5 µm thick) were stained with haematoxylin and Protein Tyrosine Kinase inhibitor eosin and

only sections containing 10 or more islets were selected to be graded blindly by two observers (0, no infiltrate; 1, periductular infiltrate; 2 peri-islet infiltrate; 3 intra-islet infiltrate; and 4, intra-islet infiltrate associated with beta cell destruction) [18]. Pancreatic lymph nodes and spleens were isolated aseptically and minced to yield single-cell suspensions in culture medium with RPMI-1640 added with 10% fetal bovine serum (FBS; Sigma), 2 mM L-glutamine, 10 mM HEPES, 1 mM sodium pyruvate, 100 units/ml penicillin and 5 µg/ml streptomycin (Gibco, Grand Island, NY, USA). After centrifuging spleen cell suspensions at 300 g for 10 min, red blood cells were lysed with 3 ml of chilled red blood cell lysis buffer (Sigma) on ice for 5 min and then washed three times with chilled culture medium.

2009CB522407). The authors have no financial conflict of interest. “
“The 2011 Nobel Prize in Physiology/Medicine to Ralph Steinmann, Jules Hoffmann, and Bruce Beutler recognized a paradigm shift in our understanding of innate immunity, and its impact on adaptive immunity. The Prize highlighted

the initial discoveries of Toll’s role in immunity in flies, Toll-like receptors in mammals, and the establishment of dendritic cells as the initiators of adaptive immunity. This historical Commentary focuses on the developments in our understanding of innate immunity. In 1908, the Nobel Prize in Physiology/Medicine went jointly to Ilya Ilyrich Metchnikoff, the original champion of cellular immunity, and Paul Ehrlich, then ambassador of humoral defenses, “in recognition of their work in immunity.” Metchnikoff advocated the idea that phagocytic cells, far from being harmful to the organism, as was the Alisertib concentration current paradigm, in fact constituted a first

line of defense by nonspecifically ingesting and digesting invading pathogens and other foreign material [[1]]. His cellular theory of immunity, however, was challenged when Emil von Behring and Shibasaburo Kitasato discovered that immunity to tetanus and diphtheria was explained MK-2206 mouse by antibodies (Abs) specific for their respective exotoxins [[2]]. Subsequently, Ehrlich proposed the “side-chain theory” to explain how Abs functioned [[3]]. However, the discovery by Almoth Wright and Stewart Douglas that “the body fluids modify bacteria in a manner which renders them ready prey to phagocytes” (where body fluids can now be interpreted as Abs in immunized animals) was the first report that

both branches (cellular and humoral) of the immune system may work together [[4]]. Wright named this observation the “opsonic phenomenon,” and the factors were called opsonins (from the Greek opsono (I prepare victuals for)). Even Ehrlich, an enthusiastic Methocarbamol believer in humoral immunity, acknowledged in his landmark review of 1908 [[5]] that infections are cleared by cellular and humoral immunity. Nevertheless, most immunologists at that time became followers of the humoral theory to explain how immune defenses worked, mainly because Abs could be easily studied in a test tube. Therefore—and perhaps mirroring the work of the more chemically oriented Ehrlich—immunology began to shift from cellular immunology toward chemistry, led by scientists such as Karl Landsteiner, Felix Haurowitz, Michael Heidelberger, John Marrack, and Linus Pauling. In the early 1960s, the tide changed again and immunology transformed from a chemical to a more biological discipline mainly through the work of N. Avrion Mitchison [[6]] and Peter Medawar [[7]] who showed that cellular rather than humoral mechanisms were sufficient to account for allograft rejection, immunological tolerance, and resistance and memory against tumors.